Introduction
Soil salinization is a universal problem all over the world (Li et al. 2012), resulting in growth limitations in most plant
species and substantially decreased crop yields (Ruiz-Lozano et al. 2012). Crucial metabolic processes, including photosynthesis,
growth, energy, lipid metabolism and protein synthesis, are damaged by
salinization, causing great harm to the sustainable development of agricultural
and forestry (Boscaiu et al. 2008; Reis et al. 2012). About 1.5 billion hm2 of land is
salinized in China, and this area is increasing (Yang 2008). Thus, the
development of new saline-alkali tolerant tree varieties is urgently needed. In
traditional mutation breeding, trait predictability of the target species is
relatively poor, and production of new saline-alkali tolerant germplasm is very
difficult and inefficient. Transgenic technology can speed up breeding and
improve its efficiency by manipulating and transferring specific genes. For
example, transgenic lines of poplar, which grow normally when subjected to 200 mmol/L sodium chloride
were generated using OsNHX1 gene transfer (Wang et al. 2005). Salt tolerance was also improved after
transformation of GmNHX1, AtNHX1and HbNHX1 genes into
poplars (Xu et al. 2007; Sun et al.
2009).
Plants have developed mechanisms to survive the
deleterious effects of salt stress, including adaptations in water/osmotic
homeostasis and ion balance, damage deterrence (Munns 1993; Chen and Polle 2010; Lata et al.
2011), transport
and/or compartmentation of Na+ and K+, and enhancement of
the antioxidant system. Ion separation has been the main focus of salt
tolerance research and much attention has been paid to maintaining ion
homeostasis (Ren et al. 2005; Zhang et al.
2019), but little
research has focused on ion transporters. The SKC1 gene, which encodes
for a sodium transporter of the HKT family, was originally cloned as a salt
tolerant gene in rice. The sodium transport proteins of the HKT family are
specific for Na+ transport and do not participate in the transport of
K +, Li+, and
other cations (Ren et al. 2005). Stress resistance in plants is improved by the
up-regulation of the SKC1 gene, triggered by environment stress, such as
salt, drought, or low temperature (Yu et al. 2014; Yao et al. 2017).
To study the effects of SKC1 on salt tolerance in
poplar, the SbSKC1 gene was cloned from sorghum and transformed into
poplar. Salt stress resistance was improved in transgenic plants. Protective
enzyme activities and expression of salt-resistant genes were determined to reveal
the regulatory mechanism of SbSKC1 gene in the development of salt
tolerance in poplar. The results of this study provide the basis for further
development of new varieties of poplar with strong salt tolerance.
Materials and Methods
Plant materials
Poplar sterile seedlings were
provided by the Institute of Agricultural
Bioengineering of Guizhou University. Transgenic poplar (Populus tomentosa Carrière)
seedlings were grown at 25°C, in 10–20% humidity, with a 16 h light
photoperiod, and in a mixture of nutrient soil and perlite (3:1, v/v)
(transplanted one per pot, placed in a greenhouse). Sodium chloride treatment
was applied after 6 weeks of transplanting. Plants were treated with150 mM NaCl
solution when the plants when the plant grows 45 d, and subsequent
experiments were carried out at the same plant height.
Total RNA isolation
Total RNA was extracted
from 0.1 g leaf samples (wild type and transgenic poplar)
with a High efficiency Plant RNA Kit (Omega, USA). The cDNA was
produced from the RNA template (1.5 μg) with M-MLV reverse transcriptase
kit (TaKaRa, Dalian, China) according to the manufacturer’s directions.
Cloning of SbSKC1 and construction of
prokaryotic and plant expression vectors
A cDNA fragment of Sorghum
bicolor SKC1 containing an open reading frame was used as a template,
obtained by reverse transcription using AP (F:5'-AAGTCCATCTCCGTCCCTAGGCC-3’; R:5'TTAGCCTAGCTTCCATGCCTGACC3’) sequence as primers. The PCR product was
inserted into T vector (TaKaRa, Dalian, China) for sequencing. The pSH737
vector was cut with BamIII and XbaI, and the SbSKC1 sequence was cut with restriction sites. The vector pSH737- SbSKC1
was producedusingT4 DNA ligase. The vector contains the SbSKC1expression element, and the 35S promoter
driving the GUS::NPTII fusion gene as a screening marker and reporter (Fig. S1).
Plant
transformation and transgenic plant
detection
SbSKC1 was transformed into poplar using Agrobacterium-mediated
leaf discs. Agrobacterium containing
expression vector was suspended in MS liquid medium, and agrobacterium
concentration OD600 was adjusted to 0.6. The poplar leaves were
resuspened for 6–8 min and dried the bacteria on the leaves with sterile paper
before they were placed on the co-cultivation medium (MS+0.1 mg L-1 NAA)
for 2 d at 25±2°C under no light. Then, the co-cultivation leaves were
transferred onto the callus induction medium (MS +2.0 mg L-1 ZT+1.0
mg L-1 NAA+200 mg L-1 Timentin+50 mg L-1
Kanamycin pH 5.80), value-added medium (MS +1.0 mg L-1 6-BA+ 200 mg
L-1Timentin +50 mg L-1 Kanamycin+30 g·L-1 Sugar + 8
g·L-1 agar powder pH 5.80), bud induction medium
(MS +2.0 mg L-1 ZT+1.0 mg L-1 NAA+200 mg L-1 Timentin+50
mg L-1 Kanamycin+30 g·L-1 sugar + 8 g·L-1 agar powder pH 5.80), rooting
medium (MS + 0.1 mg L-1 NAA+200 mg L-1 Timentin+50 mg L-1
Kanamycin +30
g·L-1 Sugar + 6.5 g·L-1 agar powder
pH 5.80). When the stem were 3–5 cm, the resistant shoots were isolated from
callus and transferred them to rooting medium, rooted shoots were transplanted
into pots. From the bottom to the top take the second
and three leaves from each plant were analyzed using PCR (Yao et
al. 2016) to determine if SbSKC1
integrated into the plant.
Determination
of growth of transgenic plants
Determination of agronomic traits
based on this experimental design, the measurement
of agronomic traits in three WT plants and three transgenic plants. The plant
root length (cm) was measured with a meter ruler. The fresh weight of the
transgenic plants after the 10 d stress was measured, the roots were washed
with water before weighing, and then the plants were placed in a constant
temperature drying oven at 80°C to dry 48~72h, the dry weight was measured when
the weight of each tissue was constant.
Measurement of Na+, K+ and chlorophyll content
Poplar leaves (three wild-type
sampling and three transgenic sampling) with consistent growth were washed with
deionized water and dried for 15 min at 105°C, then baked at 70°C until there
were no changes in weight. The dried material (0.5 g) was placed in a muffle
furnace at 500°C until each sample was reduced to white ash. After cooling to
room temperature, each sample was dissolved in nitric acid solution and a flame
photometer (Flame Photometer 6400, Wincom Co. Ltd., Shanghai, China) was used
to determine Na+ and K+. Measurements
for each sample were repeated three times (Wei et al. 2012). Each transgenic and WT line was tested in triplicate
and the experiment was repeated three times. Specific chlorophyll concentration
was determined using WT and transgenic leaves obtained from each treatment
plate of the previously described chlorophyll concentration study. Leaves were
blotted dry and 100 mg of tissue from each sample was placed in a 1.5 mL
microcentrifuge tube. The samples were re-suspended in 80% acetone, ground with
a disposable pestle, and incubated
in darkness for 30 min. Total chlorophyll (mg g-1 FW) was determined using absorbance at 645 and 663 nm
according to the equation: 20.2 A645 + 8.02 A663 (Chory et al. 2014).
Measurement of MDA content and SOD,
POD and CAT activities
Potassium
phosphate buffer solution (1 mL, pH 7.8) was combined with 0.1g of plant sample
(three wild-type and three
transgenic mixed sampling TP1, TP2, TP3). Liquid nitrogen
was used to freeze samples before they were ground into a homogenate. Homogenized
samples were centrifuged (8000×g, 10 min, 4°C) and the supernatant was put on ice. SOD, POD and CAT
activities, as well MDA content (Keming Biotechnology Co., Ltd. Suzhou China)
content, were determined according to kit instructions (Zhang et al.
2009).
Quantitative RT-PCR analyses
RNA was extracted from Wild type (three wild-type sampling) and transgenic poplar leaf samples (three transgenic sampling TP1, TP2, TP3) (0.1 g)
were harvested from similar areas of the plants using RNAiso Plus (TaKaRa,
Tokyo, Japan). Total RNA was treated with RQ1RNase-Free DNase (Promega, USA) to
clear genomic DNA, after which first-strand cDNA was synthesized (Fermentas,
Burlington, ON, Canada). RT-PCR was performed in a CFX100 Real-Time PCR
instrument (Bole Biotechnology Co., Ltd., Hubei China) using SYBR Premix Ex Taq
(TaKaRa) according to the manufacturer’s instructions. Relative levels of
transcripts were determined by normalizing expression against EF1 gene transcript levels. SYBR Green
RT-qPCR assays were utilized for gene expression analysis. Gene expression
levels were calculated with the 2 –ΔΔCT method. PCR was
performed using CFX100 with a standard RT-qPCR reaction mix. The amplification
cycling conditions were as follows: 3 min at 98ºC, 15 s at 95ºC, 1 min at 60ºC,
for 39 cycles. Each sample was analyzed three times, with three replicates
each. Experiments were performed in at least three times. Primer sequences for SbSKC1 and the salt tolerance-related
genes are described (Supplement Table 1S).
Statistical analysis
In the absence of any difference between wild-type and transgenic plants
(NaCl treatment), design of the experiments was completely randomized with
three replications. Excel 2003 and
SPSS22 were utilized for statistical analyses. For multiple variable comparisons, one-way
ANOVA followed by Duncan’s multiple range post hoc analysis was utilized, P < 0.05 was considered
statistically significant.
Results
Characterization of SbSKC1 and molecular
detection of transgenic poplar
The ORF of SbSKC1
was obtained from S. bicolor
(Accession #: XM_002457691.1). Based on the sequence information, the SbSKC1 gene was 1497 bp and encode 498
aa. The cloned SbSKC1 sequence was
consistent with the database coding sequence. In order to better reveal the
genetic relationship of SbSKC1 in various plant species, we constructed a
phylogenetic tree using the amino acid sequences obtained from the GenBank
database. Blastp analysis showed that SbSKC1
shared a high degree of sequence similarity with Brachypodium distachyon (XP_003564102.3) during evolution (Fig. 1). To
elucidate the function of SbSKC1 in poplar; we cloned SKC1 from S. bicolor, transformed into poplar plants, and used PCR amplification to identify SbSKC1 expression in the transgenic
poplar strains. Transgenic poplar strains produced a band at 165 bp, while wild
type poplar plants did not (Supplement Fig.
S2).
SbSCK1 enhances root
elongation, biomass production and chlorophyll concentration
SbSKC1 is crucial to
plant responses to various stresses. The practice of transforming foreign genes
into plants is a proven method for improving resistance to various abiotic
stresses. Therefore, we investigated whether SbSKC1 improves salt tolerance in poplar. Under normal conditions,
wild type and transgenic poplar plants both displayed normal growth. Wild type
plants gradually withered, whereas transgenic poplar plants continued to grow
normally when exposed to salt stress for 10 d (Fig. 2a). The results showed
that after 10 days of salt treatment, transgenic poplar roots (Fig. 2b) increased by 39.4, 81.3 and 32.3%, respectively, and the transgenic
poplar biomass increased wild-type poplar but not significant (Fig. 2c). The results showed
that the chlorophyll content in TP1 and TP3 increased by 39.25 and 52.88%, respectively,
after salt stress (Fig. 2c). These results demonstrated that
transforming SbSKC1 into poplar
plants improves their salt tolerance.
Effects of SbSCK1 expression on Na+
and K+ concentrations on plants under salt stress
Fig. 1: Phylogenetic
tree analysis of SbSKC1 in poplar and
other species. Sequence alignment was performed using Clustal X software, and
the phylogenic tree was created and visualized using MEGA5
Protein
sequences used for alignment were as follow: Zea mays (PWZ31832.1); Setaria viridis (TKW12226.1);
Dichanthelium oligosanthes (OEL22209.1); Phragmites australis (BAO66166.1);
Eragrostis curvula (TVU21223.1); Panicum hallii var. hallii (PUZ57034.1);
Triticum aestivum (ABG33945.1); P. hallii (XP_025814298.1); Aegilops tauschii
subsp. Tauschii (XP_020169305.1); Brachypodium distachyon (XP_003564102.3);
Hordeum vulgare subsp. Vulgare (ABK58096.1); H. marinum subsp. Marinum
(AIL53585.1); Ananas comosus (XP_020109068.1); Prosopis alba
(XP_028799237.1); Theobroma cacao (EOY32095.1); Spinacia oleracea
(XP_021850306.1); Abrus precatorius (XP_027357415.1); Quercus suber
(XP_023882347.1 ); Trema orientale (PON86276.1); Q. suber
(XP_023881 882.1); Rosa chinensis (XP_024196593.1); Elaeis guineensis
(XP_010913851.1)
Fig. 2: Analysis
of wild type and transgenic poplar plant phenotypes following exposure to salt
stress. (a) Plants were relocated to pots with soil and vermiculite (3:1) when
they were 10 cm high. After 3 weeks of growth, plants were subjected to 150 mM
NaCl for 10 days. After treatment, wild type plants displayed clear signs of
salt stress, while transgenic plants displayed little to no damage. WT1-3:
wild type poplar, TP1-3: transgenic poplar. (b) Transgenic and wild-type poplar
root growth after 10 days of treatment and (c) Chlorophyll content (mg g-1/FW), root
dry weight (g) and root length (cm)
SbSCK1 encodes a sodium ion
transporter belonging to the HKT transporter family. To confirm that SbSCK1 transports Na+ and/or
K+ in transgenic plants, we examined Na+ and K+
levels after subjecting plants to normal and salt stress conditions. Under
normal conditions, Na+ and K+ levels were similar in wild
type and transgenic plants (Fig. 3). After exposure to salt stress, Na+
and K+ levels were increased in transgenic plants compared to levels
prior to NaCl exposure. However, compared to wild type plants, Na+ was
decreased and K+ levels rose in
Fig. 3: Ion
concentration in wild type (WT) and transgenic (TP1, TP2, TP3) poplar plants
before and after 10 d of 150 mM NaCl exposure. WT
and TP samples were mixed samples from WT and TP1-3, respectively. Data are
shown as means ± SD. (n=3; **P<0.01,
WT vs TP)
Fig. 4: SOD,POD,
CAT activities and MDA levels (a–d, respectively) in wild type (WT) and
transgenic (TP1, TP2, TP3) poplar in normal conditions and after 10 d exposure
to 150 mM NaCl. Data are shown as means ± SD from four replicates. (*P<0.05; **P<0.01, WT vs. TP)
transgenic plants after salt stress (Fig. 3a–b). Thus, SbSCK1
regulates cation content. Furthermore, salt stress induced an elevated K+/Na+
ratio in the leaves of transgenic lines compared to wild type plants, as shown
in Fig. 3c.
SbSCK1 expression
increases antioxidant enzyme activity after salt stress
SOD, POD and CAT activities in whole seedlings under normal and salt
stress conditions are shown in Fig. 4. No significant differences in SOD, POD
and CAT activities were detected when plants were grown under normal
conditions. When subjected to salt stress for 10 d, SOD, POD and CAT activities
were significantly elevated in transgenic plants compared to wild type plants,
indicating that SbSCK1
improves plant response to salt stress by elevating antioxidant enzyme
activities.
SbSCK1 expression suppresses MDA after salt
stress
Antioxidant enzymes scavenge reactive oxygen species (ROS) and, thereby,
lower membrane lipid peroxidation (Gechev et al. 2006). MDA is produced by ROS-mediated lipid
peroxidation and is used as a biomarker for ROS-mediated injuries in plants.
Under normal growth conditions, no differences in MDA levels were detected
(Fig. 4d). In contrast, transgenic lines contained significantly lower levels
of MDA compared to wild type plants after 10 d of salt stress (Fig. 4d). These
data indicate that transgenic plants developed less membrane damage compared to
wild type, and suggest that overexpression of SbSCK1 protects plants from salt stress-induced membrane lipid
peroxidation.
Fig. 5: Salt
tolerance-related genes and SKC1 gene expression in wild type and
transgenic plants subsequent to 150 mM NaCl exposure for 10 d. SbSKC1 overexpression
in poplar induced stress related gene expression. Expression levels of
SbSKC1 (a), ERF76 (b), SOD1 (c), LEA1 (d), P450 (e)
and Lac1 (f) in intact leaves were determined using RT-qPCR. Means ± SD
are shown. (n=3; * p<0.05; **P<0.01; WT vs. transgenic)
SbSKC1 influences the expression of salt-tolerant genes
SbSKC1 transgenic poplar were
more tolerant to salt stress than wild type plants, however, the molecular
mechanism of this improved tolerance is unknown. We, therefore, investigated
the expression of salt-tolerant genes, including ERF76, SOD1, LEA1, P450 and Laccase1, as well as the expression of SbSKC1 in wild type and
transgenic poplar after 10 d exposure to salt stress. ERF76 gene expression was 1.34-fold higher (Fig.
5b), SOD1 was 16.7–21.91 folds higher (Fig. 5c), LEA1 was
1.72–3.18 folds higher (Fig. 5d), P450 was 2.23–2.61 folds higher (Fig.
5e), and Laccase1 was 1.36–321.43 folds higher in transgenic plants
compared to wild type (Fig. 5f).
Discussion
When soil contains elevated sodium salts, plants take up more Na+
and less K+. The Na+ uptake and dissemination throughout
the plant govern salt sensitivity (Ruiz-Lozano et al. 2012). Na+ is toxic to cell metabolism,
thus, plants have evolved a number of biochemical and molecular mechanisms to
manage the deleterious influences of elevated soil salinity. Genes, which are
crucial for ionic homeostasis, regulate Na+ and/or K+
transport and compartmentation. Ion transporters include the SOS1 Na+/H+
antiporter, the HKT transporter family and the NHX tonoplast Na+/H+
antiporter family (Blumwald and Poole 1986; Munns 2005; Ruiz-Lozano et al. 2012). In this paper, salt tolerance was
investigated after overexpression of S.
bicolor SKC1 in poplar. Results demonstrate that, compared to wild type
plants, salt stress induces a less damaged phenotype inSbSKC1 transgenic poplar. Transgenic plants displayed only slight
leaf wilting, suggesting that SbSKC1 improves the salt tolerance of
poplar plants.
High salt conditions can cause plants to dramatically
increase their Na + content, resulting in toxicity. The absorption
of Na+ and K+ by plants is antagonistic (Shen 2010), such
that when one cation increases, the other decreases (Wu et al. 2010). Plants need to sustain a high ratio of K+
to Na + for proper growth. In poplar expressing SbSKC1, we found thatK+ levels
average increased by 16.4%, Na+ average decreased by 27.25%, and K+/Na+
average increased by 58.73%, relative to wild type plants. These results
indicate that SbSKC1 overexpression
regulates cation content. When comparing antioxidant enzymes in transgenic and
wild type plants, no significant differences were observed when plants were
grown under normal conditions. In contrast, the activity of SOD was average
increased by 616.67% in transgenic plants, the activity of CAT was average
increased by 56.8% in transgenic plants,while POD activity
average increased by 56.32% compared to wild type plants when both were
subjected to salt stress. Furthermore, MDA content average decreased by 30.45%
in transgenic plants versus wild type, indicating less membrane lipid
peroxidation and the maintenance of proper membrane function under NaCl stress.
Thus, SKC1 transgenic plants display
an improved ability to remove free radicals, which facilitates superior growth
in salt alkali environments.
The expression of SKC1 gene affects the expression of salt-tolerant genes. Ethylene
response factor (ERF) transcription factors respond to drought and salinity
stress (Yan et al. 2013), and
overexpression of these genes enhances plant resistance to abiotic stress (Hu
and Liu 2011; Nakano et al. 2006).
For example, overexpression of ERF76 increases salt tolerance in plants
(Yao et al. 2016). Meanwhile, SOD1
improves plant disease resistance and late embryogenesis abundant (LEA)
proteins inhibit protein aggregation caused by water stress (Goyal et al. 2005). Plant salt tolerance is
improved by salt stress-induced P450 gene expression (Mao et al. 2013). Laccase gene expression boosts
drought tolerance in transgenic Arabidopsis
strains,SOD, POD and CAT activities are
elevated and MDA levels are decreased in transgenic laccase strains compared to wild type plants (Chen et al. 2004; Tao et al. 2005; Zhang et al.
2012). We demonstrate, in this study, that SbSKC1
gene overexpression in poplarin creases the expression of ERF76, SOD1, LEA1, P450 and
laccase1 compared to wild type plants
following salt stress. These data suggest that SbSKC1 may be involved in the process of ion osmotic during salt stress, and might function to improve plant salt tolerance.
Conclusion
The overexpression of SbSKC1 in transgenic poplar
increases cation content, antioxidant enzymes, and salt tolerance-related genes
to improve salt tolerance. Poplar is
somewhat inferior to herbaceous plant models, such
as Arabidopsis thaliana and tobacco. Nonetheless,
transformation of exotic genes in poplar is important for studying gene
function and physiology of tree species.
Acknowledgments
This work was supported by Guizhou Tea Industry Technology Innovation Center (Zhuke Zhongdi
[2017] 4005) and by the Major Projects of the National New Varieties of
Genetically Modified Organisms (No.2014ZX08010-003-2016ZX08010-003). The
authors thank Litang Lu for technical assistance.
References
Blumwald ER, J Poole (1986). Na+/H+
antiport in isolated tonoplast vesicles from storage tissue of Beta vulgaris. Plant Physiol 80:727–731
Boscaiu M, C Lull, A Lidon, I Bautista, P Donat, O
Mayoral, O Vicente (2008). Plant in response to abiotic stress in their natural
habitats. Bull UASVM65 (Hortic)
65:53–58
Chen JZ, LR Song, J Dai, NO Gan, ZL Liu (2004). Effects
of microcystins on the growth and the activity of superoxide dismutase and
peroxidase of rape (Brassica napus L.) and rice (Oryza sativa
L.), Toxicon 43:393–400
Chen S, A Polle (2010). Salinity tolerance of Populus. Plant Biol 12:317–333
Chory J, D Reinecke, S Sim, T Washburn,
M Brenner (2014). A role for cytokinins in de-etiolation in Arabidopsis (det
mutants have an altered response to cytokinins). Plant Physiol 104:339–347
Gechev TS, BF Van, JM Stone, I Denev, C Laloi (2006).
Reactive oxygen species as signals that modulate plant stress responses and
programmed cell death. Bio Essays
28:1091–1101
Goyal K, JL Walton, A Tunnacliffe (2005).
LEA proteins prevent protein aggregation due to water stress. Biochem J 388:151–157
Hu LF, SQ Liu
(2011). Genome-wide identification and phylogenetic analysis of the ERF
gene family in cucumbers. Genet Mol Biol
34:624–633
Lata C, A Yadav, M Prasad (2011). Role of plant
transcription factors in abiotic stress tolerance. In: Abiotic Stress Response in Plants –
Physiological, Biochemical and Genetic Perspectives. Shanker A, B
Venkateswarlu (eds). pp:269–296. In Tech Open,
London, UK
Li
JG, LJ Pu, M Zhu, RS Zhang (2012). The present situation and hot lssues in the
salt-affected soil research. Acta Geogr
Sin 67:1233–1245
Mao GH, T Seebeck, Schrenker, O Yu (2013). CYP70983,
a cytochrome P450 monooxygenase gene involved in salt tolerance in Arabidopsis thaliana. BMC Plant Biol 13; Article 169
Munns R (1993). Comparative physiology of salt and water
stress.Plant Cell Environ 25:239–250
Munns R (2005). Genes and salt tolerance: Bringing them
together. New Phytol 167:645–663
Nakano T, K Suzuki, T Fujimura, H Shinshi (2006).
Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol 140:411–432
Reis SPD, AM Lima, CRBD Souza (2012). Recent molecular
advances on downstream plant responses to abiotic stress. Intl J Mol Sci 13:8628–8647
Ren ZH, JP Gao, LG Li, XL Cai, W Huang, DY Chao, MZ Zhu,
ZY Wang, S Luan, HX Lin (2005). A rice quantitative trait locus for salt
tolerance encodes a sodium transporter. Nat
Genet 37:1141–1146
Ruiz-Lozano JM, R Porcel, C Azco´n, R Aroca (2012).
Regulation by arbuscular mycorrhizae of the integrated physiological response
to salinity in plants. New challenges in physiological and molecular studies. J Exp Bot 63:4033–4044
Shen X (2010). Salt-induced expression of genes related
to Na+/K+ and ROS homeostasis in leaves of salt-resistant
and salt-sensitive poplar species. Plant
Mol Biol 73:251–269
Sun WB, DX Deng, LH Yang, GQ Zhu (2009). Expression of GmNHX1
gene in transgenic Populus deltoides
× P. euramericana ‘Nanlin895' and its
salt tolerance analysis. J Fujian Agric
For Univ (Nat Sci Edn) 43:34–38
Tao JSG, CY Chen, Y Qin, T Li, KM Zhang (2005).
Influences of salt – alkali stress on MDA
and protective enzyme activity of Popular varieties. J Northeast For Univ 33:13–14
Wang SY, QJ Chen, WL Wang, XM Wang, LU Zhu (2005). Salt
tolerance conferred by over-expression of OsNHX1 gene in poplar 84K. Chin Sci Bull 50:225–229
Wei H, QY Qian, W Yan, C Rui, MD Xiao, W Jie, YZ Shi, JC
Ming, HC Li, H Chao (2012). Overexpression of a wheat aquaporin gene, TaAQP8,
enhances salt stress tolerance in transgenic tobacco. Plant Cell Physiol 53:2127–2141
Wu YS, CL Chen, YH Xiong, YP Huang, WH Zhou, LX Xu, JH
Yin (2010). Research progress of Na+/K+ transporters in
plants. Acta Agric Jiangxi 22:37–41
Xu WJ, ZP Liu, XH Long, W Zhou (2007). Transformation of
Populus×euramericana with AtNHX1 gene mediated by Agrobacterium tumefaciens. Plant Physiol Commun 43:413–416
Yan HW, L Hong, YQ Zhou, HY Jiang, SW Zhu, J Fan, BJ
Cheng (2013). A genome-wide analysis of the ERF gene family in sorghum. Genet Mol Res 12:2038–2055
Yang JS (2008). Development and prospect of the research
on salt-affected soils in china. Acta
Pedol Sin 45:837–845
Yao WJ, LZ Wang, BR Wang, SJ Li, RH
Jiang (2016). Over-expression of poplar transcription factor erf76 gene confers
salt tolerance in transgenic tobacco. J Plant Physiol 198:23–31
Yao XZ, LT Lv, DG Zhao (2016). Cloning
of SbSKIP Gene from sorghum (Sorghum bicolor) and analysis of
drought-resistant function in tobacco (Nicotiana
tabacum). J Agric Biotechnol
24:1500–1511
Yao XZ, Y Liu, DG Zhao (2017). Cloning
of SbSKC1 encoding Na+
transporter protein from sorghum and its function of salt-resistance in
tobacco. Acta Agron Sin 43:190–200
Yu ZJ, QA Cai, YZ Liu, GX Qi, R Ma, YS Dong (2014).
Genetic transformation of Na + transporter gene SbSKC1 into soybean
mediated with Agrobacterium. Jilin Acad Agric
Sci 39:1–5
Zhang H, Z Liu, Y Zhang, R Yang, X Guo, G Wang (2019). Salt stress
changes the ion homeostasis via differential K+ uptake ways in
salt-sensitive/tolerant wheat (Triticum
aestivum) varieties. Intl J Agric Biol 21:733‒742
Zhang SC, CL Ju, XJ Wang (2012). Arabidopsis laccase
gene AtLAC4 regulates plant growth and responses to abiotic stress. Chin Bull Bot 47:357–365
Zhang ZL, WJ Qu, XF Li (2009). Experimental Guide of Plant Physiology, Higher Education Press, Beijing,
China